Here is a sample session with seqret Extract an entry from a database and write it to a file: % seqret Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: Go to the input files for this exampleGo to the output files for this example Example 2 Read all entries in the database 'tembl' that start with 'hs' and write them to a file. In this example the specification is all done in the command line and to stop Unix getting confused by the '*' character, it has to have a backslash ('\') before it: % seqret tembl:hs\* hsall.seq Reads and writes (returns) sequences Go to the output files for this example Example 3 seqret does not read in features by default because this results in slightly faster performance. If however you wish to read in features with your sequence and write them out on output, using '-feature' will change the default behaviour to use any features present in the sequence. N.B. use embl format for the output file as the default format 'fasta' reports the features in gff (file "<seqname>.gff") % seqret -feature Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: embl::hsfau.embl Go to the output files for this example Example 4 Display the contents of the sequence on the screen: % seqret Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: stdout >HSFAU X65923.1 H.sapiens fau mRNA ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc agctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacggtcg cccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgc tcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggaggccc tgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaagaaga agacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtgccca cctttggcaagaagaagggccccaatgccaactcttaagtcttttgtaattctggctttc tctaataaaaaagccacttagttcagtcaaaaaaaaaa Example 5 Write the result in GCG format by using the qualifier '-osformat'. % seqret -osf gcg Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.gcg]: Go to the output files for this example Example 6 Write the result in GCG format by specifying the format in the output USA on the command line. % seqret -outseq gcg::hsfau.gcg Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau Example 7 Write the result in GCG format by specifying the format in the output USA at the prompt. % seqret Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: gcg::hsfau.gcg Example 8 Write the reverse-complement of a sequence: % seqret -srev Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: Go to the output files for this example Example 9 Extract the bases between the positions starting at 5 and ending at 25: % seqret -sbegin 5 -send 25 Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: Go to the output files for this example Example 10 Extract the bases between the positions starting at 5 and ending at 5 bases before the end of the sequence: % seqret -sbegin 5 -send -5 Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hsfau output sequence(s) [hsfau.fasta]: Go to the output files for this example Example 11 Read all entries in the database 'tembl' that start with 'hs' and write them to a file: % seqret Reads and writes (returns) sequences Input (gapped) sequence(s): tembl:hs* output sequence(s) [hs989235.fasta]: hsall.seq
